What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

Question

asked Jan 10, 2019 131k views

1 Answer

Peet Whittaker · Answer 1 · 2019-01-15T16:00:13+0000

In biology, specifically in terms of genetics and DNA, complementary means that the polynucleotide strand paired with the second polynucleotide strand has a nitrogenous base sequence that is the reverse complement, or the pair, of the other strand.

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

Please log in or register to add a comment.

Please log in or register to answer this question.

1 Answer

Please log in or register to add a comment.

Related questions

Categories

Other Questions