Question

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–adenine RNA–DNA base pairs 5 ′ − GGCCCUUUUAGGGCCUUUUU − 3 ′ a palindromic GC‑rich region followed by a sequence of uracil residues in the RNA a stem‑loop hairpin structure preceded by a sequence of uracil residues

Answer 1

The correct answer is "a palindromic GC‑rich region followed by a sequence of uracil residues in the RNA".

Step-by-step explanation:

Hairpin loops are among the most common structures that mRNA could form that result in transcription termination. These structures are formed when a region of the mRNA base pairs with another region in the same strand, which often occurs in mRNAs with palindromic GC‑rich region followed by a sequence of uracil residues in the RNA. The GC-rich regions base pairs to each other and the sequence of uracil residues are the ones that form the head of the hairpin loop.