Register

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?
asked 25.7k views
0 votes
If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

asked
User Jkgeyti
by
8.1k points

1 Answer

4 votes
UACCGCUCCGCCGCUCGACAAUACC
answered
User Voskart
by
8.4k points
← Prev Question Next Question →

No related questions found

Ask a Question
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.

Categories

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
Why aren't all minerals gemstones?
What are three important types of forces
Link Copied!